Определение пола хмеля обыкновенного (Humulus lupulus L.) при помощи молекулярных методов
Доказана применимость тест-систем для определения пола Хмеля обыкновенного (Humulus lupulus) на основе классической ПЦР. Создана тест-система на основе ПЦР в режиме реального времени.
Хмель и определение его пола до нас
В культуру введен ряд двудомных растений. Хмель обыкновенный – важнейшее из них. Наибольшей хозяйственной ценностью обладают женские растения. Поскольку морфологически пол хмеля проявляется только через 2–3 года после прорастания, важное значение имеет разработка тест-системы для диагностики пола. Результатом изучения механизмов детерминации пола Хмеля обыкновенного явилось создание тест-системы, основанной на сведениях о цитогенетических различиях клеток мужских и женских растений. К сожалению, использование этой тест-системы сопряжено с рядом неудобств, так как для анализа подходят лишь клетки образовательной ткани в стадии метафазы. Для упрощения ранней диагностики пола группой А. Полей была разработана тест-система на основе классической ПЦР, мишенью для которой стал фрагмент ДНК, специфичный для Y-хромосомы, однако и она не лишена недостатков, из-за риска загрязнения образцов посторонней ДНК, что может привести к ложноположительному результату реакции и неправильному определению пола диагностируемого растения.
Объекты исследования
В работе использовались 3 образца с мужских и 2 образца с женских растений Хмеля обыкновенного (Humulus lupulus) дикого типа для проверки предложенных методов определения пола и 8 образцов растений хмеля обыкновенного сортов Amarillo, Crystal и Nugget, заказанных в питомниках Италии. Растения получены в виде семян. Растения были пророщены и укоренены. На момент исследования эти 8 растений ещё не сформировали генеративных органов, поэтому пол растений предстояло определить в ходе самого исследования.
Методы исследования
Приготовление препаратов ДНК производилось CTAB-методом.

Постановка ПЦР производилась в центрифужных пробирках объемом 600 мкл, объем реакционной смеси – 20мкл на пробирку. В микроцентрифужной пробирке были смешаны компоненты реакции (из расчета на одну пробирку): 10х буфер для Taq-полимеразы – 2мкл, 25мМ магния хлорид– 2мкл, 5мМ трифосфаты нуклеотидов – 0.5 мкл, 10мкМ праймер прямой – 0.5 мкл, 10мкМ праймер обратный – 0.5 мкл, 5 е.а./мкл Taq-полимераза– 0.5 мкл, 2% БСА – 2мкл, вода – 11,5 мкл, 0,5 мкл препарата ДНК. В одну из пробирок вместо ДНК добавляли 0,5 мкл воды, она служила отрицательным контролем. После внесения препарата ДНК в каждую пробирку было добавлено по 2 капли минерального масла.

Использовались праймеры STS (STSF: ACAGAGTACAACTCAGAAACAAACC,
STSR: AAGGTCGCACAATGACCG) (J. Patzak et al, 2002; A. Polley et al, 1997), ITS (ITS4:TCCTCCGCTTATTGATATGC, ITS5: GGAAGTAAAAGTCGTAACAAG).


Реакцию с праймерами STS проводили по программе: начальная денатурация – 94°С (5 мин), далее 45 циклов: 94°С (15 с), 54°С (30 с), 72°С (60 с), финальная элонгация – 72°С (5 мин), с праймерами ITS4/5 - начальная денатурация – 94°С (5 мин), далее 40 циклов: 94°С (5 с), 55°С (30 с), 72°С (40 с), финальная элонгация – 72°С (5 мин).

Анализ результатов ПЦР произведен методом электрофореза в агарозном геле.

С продуктами ПЦР с STS-праймерами были проведены подготовка ПЦР-продуктов к секвенированию и секвенирование.

Подбор праймеров и зондов для ПЦР в режиме реального времени на основе полученных сиквенсов производился вручную в программе Vector NTI (Invitrogen) с учётом следующих характеристик:
1) разница температур отжига зондов и праймеров Δt ≈ 10°C,
2) длина праймеров ≈ 21 н.,
3) длина зонда ≈ 28 н.,
4) длина целевого фрагмента ≤ 300 н. п.
5) минимальное количество вторичных структур.

ПЦР-продукты были очищены с помощью препаративного электрофореза в агарозном геле и отданы на секвенирование по Сенжеру, которое не дало результатов. В связи с этим, было принято решение клонировать ПЦР-продукты в плазмиду pJet1.2. Клонирования плазмида, содержащая целевую последовательность, была выделена и успешно отсеквенирована. Сиквенс депонирован в международной базе данных NCBI (KY348696). Анализ полученного сиквенса показал, что аннотированных последовательностей, аналогичных данной, в базах данных NCBI не обнаруживается. Реальная длина фрагмента вместе с праймерами оказалась равна 1116п.н.
На основании полученной последовательности была сконструированна диагностическая тест-система HLRT2.


HLRT2_F: CTATGCCAACTTGAAGAGGGAT

HLRT2_R: ACCTTCCTGACTCCAACGTAGA

HLRT2_Pr: FAM- TATGAAACACTTCTCTTTTAAGGTGGTGCC- BHQ1

Тест-система HLRT2 сработала корректно, дав положительный сигнал на всех образцах мужской ДНК (рис. 1) и отсутствие положительного сигнала на ДНК женских растений (рис. 2).
Сводные данные по результатам ПЦР со всеми тест-системами и на всех образцах.
Выводы

1. Произведена проверка тест-системы для определения пола у хмеля на основе классической ПЦР, описанной Patzak (J. Patzak et al, 2002; A. Polley et al, 1997). Тест-система работает корректно.

2. Выполнена разработка тест-системы для определения пола у хмеля на основе ПЦР в режиме реального времени.

3. Разработанная тест-система на основе ПЦР-РВ проверена. Она работает корректно и позволяет определить пол у растений хмеля обыкновенного.

4. С помощью обоих корректно работающих тест-систем определен пол опытных растений, участвующих в эксперименте.

Благодарности

Авторы работы выражают искреннюю благодарность коллективу биотехнологической компании ООО «Бигль» за предоставленную возможность работать на оборудовании компании и за предоставленные расходные материалы, сотрудникам лаборатории генной и клеточной инженерии растений СПбГУ, помогавшим осуществлению работы и принявшим в ней участие, а также лично: Андреевой Е.А. за проведение секвенирования ПЦР-продукта и плазмиды и, Полеву Д.Е. за помощь в получении семенного материала из Италии.
Без этих людей работа не смогла бы состояться в представленном виде.


Литература

[1] Bull J.J. (1983): Evolution of Sex Determining Mechanisms. Menlo Park, California: Benjamin/Cummings Publishing p. 271-297.

[2] Charlesworth D. (2016): Plant Sex Chromosomes. Annual Review of Plant Biology , 67: 397-420

[3] Charlesworth D. (2002): Plant sex determination and sex chromosomes. Heredity, 88: 94—101.

[4] Clark M.S., Parker J.S., Ainsworth C.C.(1993) Repeated DNA and heterochromatin structure in Rumex acetosa Heredity, 70:527—536.

[5] Dellaporta S.L., Calderon-Urrea A. (1993): Sex determination in flowering plants. Plant Cell, 5: 1241-1251

[6] Ferguson M.W.J., Joanen T. (1982): Temperature of egg incubation determines sex in Alligator mississippiensis. Nature, 296, 850—853.

[7] King R.C; Stansfield W.D. and Mulligan P.K. (2006). A dictionary of genetics., Oxford University Press 7:194., 609p.

[8] Natsume S. et al. The Draft Genome of Hop (Humulus lupulus), an Essence for Brewing (2015) Plant Cell Physiol., 56(3):428-441

[9] Neve R.A. (1991): Hops. Chapman and Hall, London: 10-16.

[10] Parker J.S., Clark M.S. (1991): Dosage sex-chromosome systems in plants. Plant Sci., 80:79-92.

[11] Otto Wilhelm (1886): Prof. Dr. Thome's Flora von Deutschland, Osterreich und der Schweiz in wort und Bild fur Schule und Haus. Gera-Untermhaus, E. Kohler: 89.

[12] Polley A, Ganal M.W., Seigner E. (1997) Identification of sex in hop (Humulus lupulus) using molecular markers. Genome. Jun; 40(3):357-61

[13] Saiki R.K., Gelfand D.H., Stoffel S., Scharf S.J., Higuchi R., Horn G.T., Mullis K.B., Erlich H. A. (1988): Primer-Directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase. Science, 239: 487-491.

[14] Smith C. A., Roeszler K. N., Ohnesorg T. et al. (2009): «The avian Z-linked gene DMRT1 is required for male sex determination in the chicken». Nature 461 (7261): 267—271.

[15] Westergaard M. (1958): The Mechanism of Sex Determination in Dioecious Flowering Plants. Advances in Genetics, 9:217–281

[16] Александров О.С. Молекулярно-цитогенетическое изучение половых хромосом у видов Humulus lupulus и Humulus japonicus. Автореферат диссертации, Москва, 2010.

[17] Гаммерман Л.Ф., Гром И.И. Дикорастущие лекарственные растения СССР. – М.: Медицина, 1976 – 57 с.

[18] Глик Б., Пастернак Дж. Молекулярная биотехнология. Принципы и применение. Пер. с англ. — М.: Мир, 2002.

[19] Губанов, И.А.; Крылова, И.Л.; Тихонова, В.Л. Дикорастущие полезные растения СССР – М.: Мысль, 1976 г – 100 с.

[20] Матвеева Т.В., Богомаз Д.И, Лутова Л.А. Малый практикум по генной инженерии — СПб:«Реноме», – 2001.

[21] Меледина Т.В. Сырье и вспомогательные материалы в пивоварении – СПб: Профессия, 2003 – 276 с.
Made on
Tilda